The Puzzling Quirks of Regular Expressions
Support the author!
Lulu Editions
Paypal Donation
Other Publications
In the last puzzle, we reimplemented str.count()
using regular expressions. However, the solutions I presented—and most likely the solution you arrvied at on your own—ultimately came down to utilizing len()
on something derived from the original string (to count the number of matches found).
For this puzzle, pretend that Python also does not have the len()
function; and also do not implement your own equivalent by, for example, looping through an iterable and incrementing a counter when a substring is found. One way to express this is that your function should use no numeric variables or values.
In fact, what we want as the result is a string that represents the number of the count, not an actual number. To simplify the problem, however, we can assume that we are only counting single characters, not substrings in general. In fact, to simplify even more, let’s just assume the input strings are exclusively nucleotide symbols like in the example below (generalizing this isn’t too difficult). A solution will look something like this:
>>> def let_count(char: str, string: str) -> str:
# maybe a while loop, some calls to re.something()
... ...
For example, using it to count nucleotides:
>>> mRNA = '''
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACCAT
GTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGAGCAGCCAGTGCGTGAACCTGACCACCC
GGACCCAGCTGCCACCAGCCTACACCAACAGCTTCACCCGGGGCGTCTACTACCCCGAC
AAGGTGTTCCGGAGCAGCGTCCTGCACAGCACCCAGGACCTGTTCCTGCCCTTCTTCAG
CAACGTGACCTGGTTCCACGCCATCCACGTGAGCGGCACCAACGGCACCAAGCGGTTCG
ACAACCCCGTGCTGCCCTTCAACGACGGCGTGTACTTCGCCAGCACCGAGAAGAGCAAC
ATCATCCGGGGCTGGATCTTCGGCACCACCCTGGACAGCAAGACCCAGAGCCTGCTGAT
CGTGAATAACGCCACCAACGTGGTGATCAAGGTGTGCGAGTT
'''
>>> let_count('G', mRNA)
'120'
>>> let_count('C', mRNA)
'152'
>>> let_count('T', mRNA)
'74'
>>> let_count('A', mRNA)
'109'
Before you turn the page…
Write a Python function with the restrictions given.
This one turns out to be somewhat difficult, but also to be possible, which is itself sort of amazing. No numbers whatsoever are involved in the solution shown. No counters, no integer variables, no Python functions returning numbers.
We also do not need to use any Python string methods, although it is fair to note that some of what is performed via regular expressions might be more simple to express as string methods. The function can perform strictly and only regular expression operations… along with a little bit of Python looping (but never over numbers).
We use two sentinels in alternation for the loop, indicating either the number of items at a certain power of ten, or the number at the next higher power. A dictionary can map zero to nine repetitions of a sentinel to the corresponding numeral, but leave the rest of the string unchanged.
# Group 1: zero or more leading @'s
# Group 2: some specific number of _'s
# Group 3: anything until end; digits expected
= {
counter r'(^@*)(_________)(.*$)': r'\g<1>9\g<3>',
r'(^@*)(________)(.*$)': r'\g<1>8\g<3>',
r'(^@*)(_______)(.*$)': r'\g<1>7\g<3>',
r'(^@*)(______)(.*$)': r'\g<1>6\g<3>',
r'(^@*)(_____)(.*$)': r'\g<1>5\g<3>',
r'(^@*)(____)(.*$)': r'\g<1>4\g<3>',
r'(^@*)(___)(.*$)': r'\g<1>3\g<3>',
r'(^@*)(__)(.*$)': r'\g<1>2\g<3>',
r'(^@*)(_)(.*$)': r'\g<1>1\g<3>',
r'(^@*)(_*)(.*$)': r'\g<1>0\g<3>'
}
A first step is to map the target character to a sentinel. It would be easy to extend the main function to map a generic regular expression pattern to that same sentinel.
The two sentinels underscore and at-sign are used here, but some rare Unicode codepoint in the astral plane—or even a private-use codepoint—could just as well be used instead if collision with the initial string were a concern.
def let_count(c, s):
# First lines only convert single char to sentinel,
# but could be generalized to any regex pattern
# Remove everything that isn't the target character
= re.sub(fr'[^{c}]', '', s)
s # Convert the target to the underscore sentinel
= re.sub(fr'{c}', '_', s)
s
# Loop indefinitely: do not know number digits needed
while True:
# Ten underscores become an @ sign
= re.sub(r'__________', '@', s)
s for k, v in counter.items():
# Replace trailing underscores with a digit
= re.sub(k, v, s)
new # Some pattern matched, so exit the loop
if new != s:
= new
s break
# If we have only digits, we are done
if re.match(r'^[0-9]*$', s):
return s
# Convert from "unprocessed" to "todo" sentinels
= re.sub('@', '_', s) s